Chris Castig Co-founder of Console.xyz. Adjunct Prof at Columbia University Business School.

What I Learned Biohacking My Genes

2 min read

In 2018, Chinese scientist He Jiankui created the world’s first genetically altered babies: two twins with a resistance to H.I.V.

He did this used the gene-editing tool Crispr. 

On one hand Crispr is fascinating! But on the other hand, it’s terrifying. If we can create H.I.V. resistant humans, then what’s next? Babies born with a resistance to the flu? Children born with super-human abilities? And what if there’s a glitch and doctors don’t find the problem until 3 generations of humans later? Then what?

These are just a few of the concerns being raised, and it’s why over one hundred Chinese scientists called Dr. Jinkui’s experiment “a huge blow to the global reputation and development of Chinese science.”

I’ve been fascinated by the promise, as well as the doomsday scenarios, surrounding Crispr. But I admit, I know very little about how DNA works. And that’s why I was so grateful to have stumbled upon Genspace.

What is Genspace?

Ryan Shea pipetting at Genspace
Ryan Shea pipetting at Genspace

Genspace is the world’s first community lab. They describe themselves as, “a place where anyone can learn and work on biotechnology.”

Last week, I enrolled in their Biohacking Bootcamp — a primer on gene sequencing and editing held at their lab in south Brooklyn.

Here’s three things we learned at Genspace’s Biohacking course.

1. We decoded our own personal DNA

Geographic distribution of my type of DNA
My geographic ancestry based on my DNA

Using a Q-tip, each of us swabbed our mouths for saliva. Using saline and a few other chemicals in the lab, we were able to isolate our DNA and then send it to Genewiz who sequenced a few hundred base-pairs.

Here’s the DNA base pair results from my sequencing:

TCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACC
GCTATGTATTTCGTACATTACTGCCAGCCACC
ATGAATATTGTACGGTACCATAAATACTGAC
CACCTGTAGTACATAAAAACCCAACCCACAT
CAAAACCCCCTCCCCATGCTTACAAGCAAGT
ACAGCAATCGACCCTCAACTATCACACATCA
ACTGCAACTCCAAAGCCACCTCTCACCCACT
AGGATACCAACAAACCTACCCACCCTTAACA
GTACATAGCACATAAAGCCATTTACCGTACA
TAGCACATTACAGTCAAATCCCTTCTCGTCCCC
ATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

Based on this, I learned that my genetic population group is haplogroup U6d1a. Or to say that another way, my DNA base pairs indicate that my ancestry comes from northern Africa, and the Mediterranean Sea.  

2. We did a basic gene-modification

We altered the DNA code of the white bacteria (those white dots), so that when they reproduced they would create red bacteria.
Ecoli bacteria

In day 2 of the class we modified a strand of DNA so that when the cell reproduced the new cells would glow the color red.  

We were able to do this using Ecoli (purchased at Zymo Research) and the restriction enzyme process (a technique that allowed us to cut the Ecoli’s DNA into smaller pieces and alter it’s makeup).

3. We learned the ABCs of DNA

DNA is the original blueprint, RNA is a translated copy that is made which then creates new Protein cells

A list of notable learnings:

  • The word “Genome” refers to an organism’s complete set of DNA.
  • The human genome contains approximately 3 billion of these base pairs
  • 99.5% of all DNA is shared across all humans; it is the 0.5% that makes all the difference
  • 23andMe does genotyping, not gene sequencing. What’s the difference? Genotyping is more generally the process of finding which differences exist between you and other humans, whereas sequencing is more granular and includes decoding your specific lettered base pairs.
  • Blast is a site where you can query your basepairs of DNA with other matches of people and research around the world. Try copying in my DNA base pairs (that code of “TCTGTTCT… ” above and you’ll learn a lot more about me.)
  • Mitochondrial Eve is a woman who lived 150,000 ago and from who all living humans have descended.

Final Thoughts

Genspace is a great place to get a basic understanding of biohacking. Leave a comment below if you have more questions — I’d be happy to share any knowledge or resources I’ve gathered.


Thanks to Mattan Griffel and Alexis Rondeau for introducing me to GenSpace. 

Learn to Code Comment Avatar
Chris Castig Co-founder of Console.xyz. Adjunct Prof at Columbia University Business School.