Home

  • How I Banked My Stem Cells

    How I Banked My Stem Cells

    “Congratulations! Your cells are now 5 days younger than you are!” — my ForeverLabs profile.

    My stem cells in storage with forever labs
    My stem cells in storage

    Stem cells are self-renewal cells that, if collected young, can be used later in life for a variety of age-related disease like arthritis, heart disease, and stroke.

    Or as my friend Cedric Dahl described it to me,

    “We get to stop aging. We’re basically vampires without the whole blood drinking thing.”

    While storing stem cells doesn’t quite equate with living forever, there does seem to be a loose hope (or buzz) that as medical technology improves in the coming decades then stem cells may be used for additional up and coming anti-aging treatments.

    ForeverLabs is a company that facilitates affordable stem cell banking and storage.  In 2017 they joined the Silicon Valley accelerator Y Combinator, and that’s when they came on my radar. Last week I had my stem cells banked. Here’s a few takeaways from the experience:

    Why did bank my stem cells now?

    Apparently, the younger  your cells are when you bank them the better. Many parents are even banking their newborn’s umbilical cord blood for similar long-term health effects.

    What can banked stem cells do for you right now?

    Right now, knee arthritis seems to be one of the primary treatments for stem cells. According to my doctor, it’s fairly common for people with knee injuries to have stem cells extracted from their pelvis and injected it into their knees. And yet, the younger your stem cells are, the better off you are. Read more on ForeverLabs’s research page.

    Did it hurt?

    The procedure took about 15 minutes and didn’t hurt. I laid face down on a table, and the doctor drew bone marrow from my pelvis through my lower back. Afterwards, I felt slightly fatigued and was told not to exercise for two days. There was slight soreness in my lower back, but it was mild and went away after a few days.

    How much did it cost?

    The process is $2000 with an additional annual storage fee of $250/year. Definitely sign up for the mailing list though, because they do offer specials. After being on the mailing list for 12 months, I was able to nab the new year’s special which brought the cost down to only $500.

    Do you want to live forever?

    No thanks. The only thing greater than the anxiety of death would be the anxiety of living forever. For now, I just want to live well within the time I have — and that includes taking care of my health.

    Are you a doctor?

    Me? No. I’m not a doctor. This is all new to me, so please research stem cells for yourself, and talk to your doctor if you are interested in banking your cells. Don’t blindly follow the advice of some random guy on the internet.

    Final Thoughts

    Overall, I think of ForeverLabs as an investment in the future. Just like any investment, there’s no guarantee of success, but the potential upside is huge compared to the initial cost.

    It’s also a small drop in the bucket compared to health insurance (I pay $500/month) and of course in America these costs get higher with age.

     

  • What I Learned Biohacking My Genes

    What I Learned Biohacking My Genes

    In 2018, Chinese scientist He Jiankui created the world’s first genetically altered babies: two twins with a resistance to H.I.V.

    He did this used the gene-editing tool Crispr. 

    On one hand Crispr is fascinating! But on the other hand, it’s terrifying. If we can create H.I.V. resistant humans, then what’s next? Babies born with a resistance to the flu? Children born with super-human abilities? And what if there’s a glitch and doctors don’t find the problem until 3 generations of humans later? Then what?

    These are just a few of the concerns being raised, and it’s why over one hundred Chinese scientists called Dr. Jinkui’s experiment “a huge blow to the global reputation and development of Chinese science.

    I’ve been fascinated by the promise, as well as the doomsday scenarios, surrounding Crispr. But I admit, I know very little about how DNA works. And that’s why I was so grateful to have stumbled upon Genspace.

    What is Genspace?

    Ryan Shea pipetting at Genspace
    Ryan Shea pipetting at Genspace

    Genspace is the world’s first community lab. They describe themselves as, “a place where anyone can learn and work on biotechnology.”

    Last week, I enrolled in their Biohacking Bootcamp — a primer on gene sequencing and editing held at their lab in south Brooklyn.

    Here’s three things we learned at Genspace’s Biohacking course.

    1. We decoded our own personal DNA

    Geographic distribution of my type of DNA
    My geographic ancestry based on my DNA

    Using a Q-tip, each of us swabbed our mouths for saliva. Using saline and a few other chemicals in the lab, we were able to isolate our DNA and then send it to Genewiz who sequenced a few hundred base-pairs.

    Here’s the DNA base pair results from my sequencing:

    TCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
    CCACCCAAGTATTGACTCACCCATCAACAACC
    GCTATGTATTTCGTACATTACTGCCAGCCACC
    ATGAATATTGTACGGTACCATAAATACTGAC
    CACCTGTAGTACATAAAAACCCAACCCACAT
    CAAAACCCCCTCCCCATGCTTACAAGCAAGT
    ACAGCAATCGACCCTCAACTATCACACATCA
    ACTGCAACTCCAAAGCCACCTCTCACCCACT
    AGGATACCAACAAACCTACCCACCCTTAACA
    GTACATAGCACATAAAGCCATTTACCGTACA
    TAGCACATTACAGTCAAATCCCTTCTCGTCCCC
    ATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

    Based on this, I learned that my genetic population group is haplogroup U6d1a. Or to say that another way, my DNA base pairs indicate that my ancestry comes from northern Africa, and the Mediterranean Sea.  

    2. We did a basic gene-modification

    We altered the DNA code of the white bacteria (those white dots), so that when they reproduced they would create red bacteria.
    Ecoli bacteria

    In day 2 of the class we modified a strand of DNA so that when the cell reproduced the new cells would glow the color red.  

    We were able to do this using Ecoli (purchased at Zymo Research) and the restriction enzyme process (a technique that allowed us to cut the Ecoli’s DNA into smaller pieces and alter it’s makeup).

    3. We learned the ABCs of DNA

    DNA is the original blueprint, RNA is a translated copy that is made which then creates new Protein cells

    A list of notable learnings:

    • The wordGenome refers to an organism’s complete set of DNA.
    • The human genome contains approximately 3 billion of these base pairs
    • 99.5% of all DNA is shared across all humans; it is the 0.5% that makes all the difference
    • 23andMe does genotyping, not gene sequencing. What’s the difference? Genotyping is more generally the process of finding which differences exist between you and other humans, whereas sequencing is more granular and includes decoding your specific lettered base pairs.
    • Blast is a site where you can query your basepairs of DNA with other matches of people and research around the world. Try copying in my DNA base pairs (that code of “TCTGTTCT… ” above and you’ll learn a lot more about me.)
    • Mitochondrial Eve is a woman who lived 150,000 ago and from who all living humans have descended.

    Final Thoughts

    Genspace is a great place to get a basic understanding of biohacking. Leave a comment below if you have more questions — I’d be happy to share any knowledge or resources I’ve gathered.


    Thanks to Mattan Griffel and Alexis Rondeau for introducing me to GenSpace. 

  • Conscious Capitalism with Corey Blake

    Conscious Capitalism with Corey Blake

    Conscious Capitalism is a way of thinking about capitalism and business that better reflects where we are in the human journey, the state of our world today, and the innate potential of business to make a positive impact on the world. Conscious businesses are galvanized by higher purposes that serve, align, and integrate the interests of all their major stakeholders.

    In this episode of On Books I discuss Conscious Capitalism, the book, the movement and the publishing company with Corey Blake.

    Corey is the publisher of Conscious Capitalism Press, the founder and CEO of Round Table Companies (RTC), and a speaker, artist, and storyteller. He previously starred in one of the 50 greatest Superbowl commercials of all time (Mountain Dew, Bohemian Rhapsody), has won 15 independent publishing awards, and has been featured on the cover of the Wall Street Journal and in the New York Times, USA Today, Inc. Magazine, Forbes, and Wired.

    Learn more about Corey and the Conscious Capitalism movement at www.on-books.com

    Links from this Episode

    • Conscious Capitalism — Whole Foods Market cofounder John Mackey and professor and Conscious Capitalism, Inc. cofounder Raj Sisodia argue that both business and capitalism are inherently good, and they use some of today’s best-known and most successful companies to illustrate their point. From Southwest Airlines, UPS, and Tata to Costco, Panera, Google, the Container Store, and Amazon, today’s organizations are creating value for all stakeholders—including customers, employees, suppliers, investors, society, and the environment.
    • From the Barrio to the Board Room – Today Robert Renteria is a successful business owner and civic leader, but he grew up as an infant sleeping in a dresser drawer. This poignant and often hard-hitting memoir traces Robert’s life from a childhood of poverty and abuse in one of the poorest areas of East Los Angeles, to his proud emergence as a business owner today.
    • Giftology — Radical generosity is the against-the-grain secret weapon of real influencers, and it will allow you to boost referrals, retention rates, and ROI like few other strategies. But be warned, gifts with strings attached backfire. There is a right, and wrong, way to give…
    • Great Leaders Grow — What is the secret to lasting as a leader? In the words of Ken Blanchard and Mark Miller, “Our capacity to grow determines our capacity to lead.” Leadership must be a living process, and life means growth.
    • Necessary Endings — Henry Cloud, the bestselling author of Integrity and The One-Life Solution, offers this mindset-altering method for proactively correcting the bad and the broken in our businesses and our lives. Cloud challenges readers to achieve the personal and professional growth they both desire and deserve—and gives crucial insight on how to make those tough decisions that are standing in the way of a more successful business and, ultimately, a better life.
    • RoundTable Press — In the spirit of collaboration that our name suggests, Roundtable Press, Inc. develops high-quality editorial and design for general trade, direct response, and continuity publishers, magazines, professional associations, corporations, and web sites. Every project is tailored to the specific requirements of the subject and to the needs of the client. Since 1981 we have been working with a broad spectrum of clients, both large and small, to create books and other merchandise of superior editorial quality in handsomely designed formats, ranging from mass-market paperbacks to luxurious gift books.

    Conscious Capitalism

  • How Should We Think About the Internet’s Legacy?

    How Should We Think About the Internet’s Legacy?

    From: A People’s History of the Internet

    How Should We Think About the Internet’s Legacy?
    The United States endures in our minds due to symbols like the Statue of Liberty. The 3 billion people who frequent the internet are in need of new symbols and stories that unite us globally on the network.
    How Should We Think About the Internet’s Legacy?
    Early pioneers of the internet: Steve Wozniak, Stewart Brand, Richard Stallman, and Tim Berner’s Lee

    “I declare the global social space we are building to be naturally independent of the tyrannies you seek to impose on us […] We are creating a world that all may enter without privilege or prejudice accorded by race, economic power, military force, or station of birth.”

    Facebook is not the internet

    How Should We Think About the Internet’s Legacy?

    We need a story that endures over generations

    How Should We Think About the Internet’s Legacy?

    Preserving the Legacy of the Internet

    How Should We Think About the Internet’s Legacy?
    The United States endures due to its storytelling. Here you see a painting of the historic signing of the Declaration of Independence. I’ve covered the Founding Father’s of the United States faces with those of the internet’s pioneers as a reflection of the absence of paintings, stories, and symbols of internet history. We have three Steve Jobs movies, but where is the movie about the ARPANET?
  • 4 Books to Raise the Level of Human Consciousness | Part 2

    4 Books to Raise the Level of Human Consciousness | Part 2

    The question, “What are you reading?” offers a window into not only what someone is reading, but also into what someone has been thinking about.

    2019 Books

    I read 35 books in 2018 — if you were to look at my bookshelf you’d see that I’ve been immersed in learning about artificial intelligence, city planning, education, and long-term thinking.

    From my list I’m excited to share with you four books that helped raise my awareness of the world around me in a very positive way. My advice: Purchase them immediately, but savor the time you spend with each one.

    1. 21 Lessons for the 21st Century

    by Yuval Noah Harari

    In 21 Lessons for the 21st Century, Harari has created an engaging, story-like narrative tying together the leading issues of our time including: technological disruption, artificial intelligence (AI), climate change, nationalism, immigration, job security, and education reform.

    Personally, I feel burdened by the daily overproduction of knowledge. My eyes are always bigger than my stomach: I consume countless articles and podcasts, but I can never fully digest it all. Can someone please just tell me what to pay attention to?

    Enter Yuval Noah Harari. 21 Lessons for the 21st Century serves as a kind of almanac for the 21st century. I love the opening line of the book, “In a world deluged by irrelevant information, clarity is power.” Clarity is exactly what Harari promises, and clarity is what he has delivered.

    2. Educated

    by Tara Westover

    Educated is the true and inspiring memoir about a girl who never had a formal high school education and yet went on to receive her Ph.D. from Cambridge University.

    To me, Educated is a story about the remarkable influence cast by those around us. Westover may not have had much support from her parents, but she didn’t get to Cambridge on her own. Along the way, there were countless people who came along and opened her eyes to the options around her — pulling her out of one reality, and into another.

    Typically, I prefer physical books, but I must say the audiobook for Educated was quite a delight! Give it a listen.

    3. Walk Through Walls: A Memoir

    by Marina Abramović

    I first came across the artist Marina Abramović when she performed “The Artist is Present” in New York City. That winter, everyone was talking about Marina Abramović!

    In “The Artist is Present,” Abramović sat down at the Museum of Modern Art, eight hours a day, every day for three months — without moving, no food or drink, and no bathroom breaks. It was beautiful.

    The Artist is Present, Marina Abramović
    The Artist is Present, Marina Abramović

    Walk Through Walls tells the stories behind some of Abramović’s greatest performances. A few of my favorite moments included tales of the 1974 piece “Rhythm 0” in which she put out a sign in a gallery that read, “There are 72 objects on the table that one can use on me as desired.” One was a loaded gun.

    Another chapter recounts her journey creating “The Lovers: The Great Wall Walk” in which she and her lover Ulay walked for 90 days from opposite ends of the Great Wall of China to meet each other in the middle.

    Abramović’s dedication to her practice is a real testament to what the mind and body are capable of when sufficiently challenged. Reflecting on her preparation for “The Artist is Present,” she writes, “I mastered the art of not sneezing.” I’m a huge fan of Abramović’s work. Reading this book opened my mind to the possibility of being more fearless, more creative, and less apologetic about my desires.

    If you’re not familiar with Marina Abramović, check out her documentary Marina Abramovic: The Artist is Present. And, of course, read her memoir.

    4. How Buildings Learn

    by Stewart Brand

    How Buildings Learn is lush with “before and after” photos that illustrate the influence of time on the world around us.

    On the cover, you’ll see a watercolor drawing of two identical row houses taken in 1857.

    New Orleans, 1875
    New Orleans, 1875

    And then again you see the same two buildings in 1993 — more than one hundred years later. Notice the transformation: both buildings grew. Their skin changed, while the brick construction helped them last.

    The same two buildings, 1993
    The same two buildings, 1993

    Buildings inevitably change with time, but what makes some get better, while others get worse? To answer that question, Brand has organized hundreds of photos, and written a poetic narrative linking together decades of lessons learned from I. M. Pei’s Media Lab, George Washington’s Mount Vernon home, Greenwich Village brownstones, and many more examples.

    I love this book because while the subject of is “buildings,” it’s really about time. What happens to the objects we create over time? What principles endure and which are merely fashionable? In the end, it turns out that buildings can learn a lot from humans, and that humans can learn a lot from buildings.

    Final Thoughts

    What are you thinking about? Leave a comment down below with some of your favorite books from the past year. Also, if you’d like to hear an audio summary, and sample from each book you can hear more on the On Books Podcast.

    PS. A few other notable books from the last year:

    Attached, by Amir Levine and Rachel Heller | Weaving the Webby Tim Berners Lee | Escape From Evil, by Ernest Becker | Here I am, Jonathan Safran Foer |Principles, Ray Dalio | Letters to a Christian Nation, Sam Harris |What the Eyes Don’t See, Mona Hanna-Attisha | Silent Spring,Rachel Carlson

    Originally published on Medium

  • Who Invented the Internet: The 50 Year Journey to Decentralize Communications

    Who Invented the Internet: The 50 Year Journey to Decentralize Communications

    In the autumn of 1969, a small group of people launched the most disruptive revolution of our time — and yet their names aren’t taught in high school history books, nor do we take off work to celebrate their birthdays. In this piece, I’d like to take a look at two questions: Who invented the internet? And what exactly they did they do?

    On October 29th, 1969 the first message on the early internet was sent from UCLA to Stanford University: it was just two letters “lo.”

    Internet
    The first message sent on the internet — On October 29th, 1969 Charlie Kline sent the internet’s first message “lo.” He had attempted to write the word “login,” but the system crashed before he could type the “g.”

    So how did we get from “lo” to “LOL’s,” cat GIFS, YouTube, Facebook and a global internet that connects over 3 billion people around the world?

    I’m about to share a sweeping history of the two people who founded the internet, the Founding Fathers if you will: Vint Cerf and Bob Kahn.

    Internet

    While working at the U.S. agency ARPA, they helped send the first message on the ARPANET, and a few years later they set out to accomplish one of the biggest and most audacious of goals: to create a global decentralized internet.

    Please note that: Over decades, thousands, if not tens to hundreds of thousands of people, have contributed their expertise to the construction and evolution of the internet.

    internet

    With that said, I’d like to focus, though, on one year in particular, 1973 — the year when the early internet, known as the ARPANET, made the leap from being a U.S. government military communications tool to a global free internet. And the two people who are responsible: Vint Cerf and Bob Kahn.

    Let’s start back in 1969:

    In 1969, there were only four computers (aka nodes) connected on the internet:

    who-invented-the-internet

    By 1971, we were up to 18 computers! Most of these computers were located at academic institutions like Stanford, UCLA, MIT, and Harvard.

    who-invented-the-internet

    And just two years later the network doubled in size: 40 computers!

    who-invented-the-internet

    Q: Do you notice anything missing from all of these maps?

    A: How about the rest of the world?

    Vint Cerf and Bob Kahn shared a vision of a global decentralized internet.

    They shared the belief that “information should be free” for all humans, and that access to the internet would “make the world a better place.” For them, it wasn’t enough to create an American owned and controlled internet. They believed everyone on the planet should benefit from this technology.

    Knock Knock — who’s there?

    It’s Canada, France, and England who are each busy building their own national networks. And they’re not very interested in joining America’s internet.

    who-invented-the-internet
    Here you see the national networks represented by wizard hats.

    At the time the international community was using the telephone system as it’s model for building this new network — aka each country would have it’s own national “internet.”

    Cerf and Kahn imagined the future differently.

    They feared that using the telephone system model would also mean that there would be international taxes and data transmission fees applied to data. Or worse, clunky adapters that you’d need for an American computer to speak with a European computer.

    who-invented-the-internet
    Imagine having to use an adaptor every time you wanted to visit an international website.

    Think about how the national electricity grid works — and now imagine a world with roughly 195 national internets, 195 email providers, and 195 Facebook’s, etc?!

    So how do you convince England, France, and Canada to join you in one global system?

    The solution: create a better internet and then give it away for free. And that’s just what Vint Cerf and Bob Kahn did.

    who-invented-the-internet
    Vint Cerf and Bob Kahn invented the TCP/IP protocol. Vint Cerf is almost always wearing a suit in real life, and so I gave him a suit. Bob Kahn isn’t wearing a dress, that’s just how I draw stick figures.

    In 1973, Vint Cerf and Bob Kahn invented the TCP/IP protocol. TCP/IP is the magic that connects the entire world together on one network. Here Vint Cerf explains their thinking at the time,

    “When Bob Kahn and I did the original designs we handed them out freely with no constraints, no patents, no other intellectual property claims for a very good reason. We wanted this to be accepted with no barriers to adoption.”

    And adopted it was!

    who-invented-the-internet
    The internet in 1993

    By 1993, the internet had truly become a global network.

    50 years later, with over 3 billion users, TCP/IP is still being used as the backbone of the internet. So what exactly did Cerf and Kahn build? What is TCP/IP?

    TCP/IP is the internet’s language

    who-invented-the-internet
    The internet is a series of wires that connect your computer to other computers. Here you see TCP (the main language of the internet) that transfers data back and forth between IP addresses.

    TCP — Transport Communication Protocol

    TCP is the standard set of codes that allow computers on the internet to speak with one another. You can just think of it as the internet’s mother tongue.

    Further, TCP doesn’t care what kind of data you send, and has no idea what packets of data it is carrying. In that way, TCP is, by design, neutral.

    IP — Internet Protocol

    IP connects your data to the internet’s address system.

    Your IP address locates your computer on the internet network.

    Every personal computer on the internet is assigned an IP address (you can find your public IP address here).
    Every website (aka. the server where a websites lives) also has an IP address. For example, if you type in the IP address 216.58.216.164 your browser will go to www.google.com.

    Today, when computer scientists speak about the internet, they often refer to it in terms of “layers.” TCP/IP is the middle layer of the tech stack between your computer and a website. You can’t actually see TCP/IP, just as you can’t see electricity as it powers your home. But it’s there, transporting packets of data from your computer, to Netflix (for example) and back.

    who-invented-the-internet

    Is TCP/IP broken?

    Over the years there have been updates and improvements to TCP/IP, but the underlying technology has remained the same for nearly 50 years.

    TCP/IP works, but it’s far from perfect.

    In a recent talk at Google, Vint Cerf outlined some of the problems with TCP/IP such as it’s inability to properly handle issues of 1) security (viruses, data hacking attacks, phishing, etc.), and 2) identity (authenticating and distinguishing good users and servers, from malicious ones).

    Cerf on the future of TCP/IP said,

    “One of the things I want to emphasize to you is that I am NOT an IP bigot. I’m not a TCP bigot. Just because I’ve been involved in designing and building that stuff does not mean that it is the place to stop. […] The important thing is that none of you should be afraid to say maybe we should do something different.”

    Over the past few years people have been doing “something different.” The Web3 movement (aka. the Blockchain Revolution, aka. crypto) is in part a mission to evolve the internet.

    Final Thoughts

    The internet has brought immeasurable benefits to humanity. Moving forward, I believe it’s important that we educate ourselves on how these tools work so that more people can be involved in building the future of the internet.

    Much like building a cathedral, the internet has taken many years, and each decade new people have come along and laid down a new block on top of the old foundation. Cerf and Kahn may have invented the primary protocol for today’s internet. But the future of the network is coming, and there’s a lot of work to be done.

    The movement needs skilled developers to build tools, it needs educated politicians in Washington D.C. who are able to regulate wisely, it needs entrepreneurs and businesses able to support its economic growth, and it needs an educated public (like me and you) able to understand, adapt, and evolve alongside the future of our global network.

    who-invented-the-internet

  • Humanity’s Adolescence

    Humanity’s Adolescence
    1. I believe that humanity is in a period of adolescence.

    Humanity’s Adolescence

    2. For many years we were just kids.

    Humanity’s Adolescence

    3. The Earth was our mother. She gave us food and cleaned up after us. She loved us. And we loved her. And then, at some point, we decided, “I want to be an adult!”

    Humanity’s Adolescence

     

    4. So we threw a hissy fit and started a revolution.

    Read the full article on Medium

  • The Secret Hacker Code

    The Secret Hacker Code

    The Secret Hacker Code

    In college, I had no idea how to code. I was determined to make my own music sharing app (like Napster!), but I didn’t have a clue how to start.

    That summer, I befriended a hacker. His name was The Lion King (seriously, as in his screen name was LionKing909). And he taught me lots of new tricks:

    The Secret Hacker Code

    The Secret Hacker Code

    But most notably, he introduced me to The Hacker Ethic — four principles that differentiate ordinary computer programmers from hackers. The Hacker Ethic inspired me deeply. Eventually, I decided I wouldn’t just learn to code: I would become a hacker.

    What follows are the four principles that differentiate ordinary computer programmers from hackers.

    The Hacker Ethic inspired me deeply. Eventually, I decided I wouldn’t just learn to code: I would become a hacker.

    What is a hacker?

    Defining hacker isn’t so straightforward. The name has an “I know it when I see it” ring to it. Most computer programmers are hackers, but not all of them.
    For some, the word hacker conjures up images of Soviet tech experts breaking into CIA computers, or criminals wearing Guy Fawkes masks, Mr. Robot-style. Those people certainly exist, but a hacker who hacks maliciously or for personal gain is a specific type of hacker known as a black hat hacker. Black hat hackers are an unfortunate distraction from all the kickass white hat hackers out there — the people who built and are continuing to build the internet that billions of people use every day!
    In general, hackers are problem solvers. Hackers are scrappy. Hackers express themselves with computer code and use their skills to solve problems.
    Steve Wozniak is a hacker, and yet Bill Gates, while he certainly has displayed hacker-ish qualities, clashed quite seriously with the hacker community in the mid-70s when he famously began selling his software. To understand the distinction, as well as the causes of many of the most famous tech decisions of the past century, by everyone from Steve Jobs, to Satoshi Nakamoto, you’re going to need to understand the secret code of hackers.
    The Hacker Ethic
    All hackers (good and evil) share a core belief that information should be free. This was distilled into text for the first time by Steven Levy in his 1984 book Hackers. In the book, Levy outlined The Hacker Ethic — a code of beliefs embraced by nearly all computer hackers. The ethics weren’t crafted by Steven Levy or any one person to dictate how hackers should act, rather they’re a reflection of the hacker culture that has grown organically over many decades.
    My hope in sharing The Hacker Ethic here is to give you a deeper understanding of how hackers think. One day you may hire a hacker, work with one, or wish to become one yourself. In that case, consider this your first step into their culture. These are the top four principles of The Hacker Ethic.

    1. “Information should be free”

    “Free” information means the freedom to copy existing code and to share that information with others.

    The first generation of hackers began with a group of students at MIT in the 1950s. After hours, they would sneak into the Lincoln Library on campus where they’d vie for a few hours to play with the $3 million TX-0 computer. Unlike today where most students have individual laptops, passwords, and seemingly unlimited time to spend on their computers, the MIT hackers shared just one computer. There were no passwords, so any one person’s code could be viewed by anyone else on the system. The early hackers were ok with this. More than ok, actually, because they quickly found value in sharing code.

    The original MIT hackers quickly began collaborating on building software. Why build competing versions of software, when we can instead work together to share knowledge and create the very best version? That’s the hackers way.

    Today the entire world benefits from the decisions of these early hackers.

    One of the most meaningful outcomes is the Free and Open Source Software movement. Started by Richard Stallman in 1985, the free software movement encourages millions of people to share, copy, and remix code.

    The Secret Hacker Code

    Today 80% of smartphones, and 80% of websites run on free software (aka. Linux, the most famous open source operating system). In addition, WordPress, Wikipedia, and nearly all programming languages are all free! All thanks to The Hacker Ethic.

    The GPL License (written by Richard Stallman), and the MIT License are two examples of software licenses that render The Hacker Ethic into a legal text. “Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the “Software”), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software…,” says the opening paragraph of the MIT license.

    These licenses help explain why no one “owns” the internet (as we’ll discuss in future chapters). Back in the 1990s, Tim Berners Lee released his original World Wide Web software under the MIT license. When Napster was shut down in 2001, it was easy for copycat sites to pop up because — you guessed it — open source versions were already free to share!

    2. Computers can change your life for the better.

    Hackers see computer programming not merely as a technical pursuit, but also as a tool for making the world a better place.

    For example, hackers can write code to automate redundant tasks…

    The Secret Hacker Code

    The Secret Hacker Code

    And they spread free information with the goal of improving the quality of human life…

    The Secret Hacker Code

    “Imagine a world in which every single person on the planet is given free access to the sum of all human knowledge. That’s what we’re doing.” — Jimmy Wales, Wikipedia Founder

    This tenet of using computers to “improve life for the better” goes all the way back to Vannevar Bush who, in 1945, published the essay “As We May Think,” in which he pressed scientists to stop building war machines and to consider using technology as a force for good.

    The Secret Hacker Code

    “As We May Think,” Vannevar Bush (1945)

    These days, the phrase “make the world a better place” has become so embedded in Silicon Valley culture that it’s satirized as a running gag on the TV series Silicon Valley. On the show, every startup founder seems to justify their actions through the mantra “we’re making the world a better place.”

    The Secret Hacker Code  

    We’re making the world a better place…

    Whether hackers these days are authentically upholding The Hacker Ethic, or just paying it lip service is up for debate. What remains true is The Hacker Ethic’s influence on both hacker culture and our society.

    3. Mistrust authority — promote decentralization

    Hackers are encouraged to think critically and to challenge the status quo.

    In the 1960s, Americans were wary of organizations where only a few powerful people controlled the flow of information. Think: Nazi Germany, The Soviet Union spying vigilantly its own people, and the omen “Big Brother is watching you” as described in George Orwell’s 1984. Hackers promote decentralization in order to dilute the concentration of power and fight to redistribute that power among the many.

    The Secret Hacker Code

    Hackers Promote Decentralization

    One way hackers promote decentralization is by building tools. Bitcoin is a tool that was created by Satoshi Nakamoto that completely removes the authority (and thus power) of banks. Bitcoin allows individuals to manage, send and receive money in a decentralized manner.

    Hackers also promote decentralization in their social organizations. WordPress is a software ecosystem that was created by thousands of developers around the world — most of who have never met each other. Many startups attempt to emulate this model of communication with flat company structure (aka. A boss-less culture) so that employees can make decisions without constantly needing to ask permission.

    4. Hackers should be judged by their hacking, not based on degrees, age, race, sex, or position

    Hackers judge each other by the quality of their code. This helps explain how Bill Gates and Mark Zuckerberg could drop out of Harvard build billion dollar companies. Code is meritocratic.

    A hacker doesn’t need permission to hack. Your ability is not defined by who you know, or your expensive computer science degree. If your dog writes JavaScript better than you, then the dog should be hired. As Bill Gates has said, “If you want to hire an engineer, look at the guy’s code. That’s all.”

    The Swarm of Bees
    The Secret Hacker Code
    A swarm of decentralized bees

    In the 1960s, the early hackers were buzzing like a gigantic swarm of bees. MIT was a beehive in the east, and Silicon Valley in the west.

    How do hundreds of bees coordinate? Contrary to popular belief, they’re not led by the queen bee — she stays in the hive. Bees rely on decentralized decision making for critical choices. It is for that reason that bees are often cited as a visual metaphor for how decentralized groups organize.

    In the 1960s, The Hacker Ethic was story that helped organize strangers around a single mission: keep code free, and make the world a better place. Everything was buzzing along smoothly. And then someone kicked the nest…

    Coming up next: The incident that spread The Hacker Ethic from the halls of academia and out into the rest of the world. And if you missed part one you can read it now at The History of the Internet.

    Very special thanks to Pippa Biddle, and Alexis Rondeau for reading early drafts and providing countless insights. The Secret Hacker Code was originally published at One Month: Learn to code in 30 Days.

  • The History of The Internet

    The History of The Internet

    A brief history of the internet from WW2 to Blockchain

    I’m 100% sure that 100% of you are addicted to the internet, and yet very few of us know where it came from, who made it, or how it works. This piece is part one of my series on the history of the internet. My hope is to show you not only where the internet came from, but in doing so, show you where it wants to go.

    The US Government developed the early internet as a technology that could survive a nuclear attack.¹ If any one computer went down, the hope was that information on the network would persist — there would be no central point of failure, everything would be decentralized.²

    50 years later, and decentralization is still the lifeblood of the internet. And so, I think it’s fitting we start there.

    Napster was the way I found decentralization.

    I was 19, and music was my symbol of freedom. But music wasn’t free. Albums were very expensive and controlled by a middle-man: the record labels. Each week, I’d go to my local record store, pay $14.99, and return home with a physical album. A CD.

    Centralized music distribution
    Centralized music distribution

    Napster changed all that. In the summer of 1999, my college roommate installed the music file sharing app on my computer. Instantly, I could connect with strangers and share music freely.

    Decentralized music file sharing
    Decentralized music file sharing

    Napster’s decentralization killed the middlemen, or at least significantly shrank their power.

    As a result, album sales cut in half over the next decade. The world memorialized the industry’s precipitous downfall, “The Year the Music Dies” (Wired 2003), “The Rise And Fall Of The Music Industry” (NPR 2009), and “Music’s lost decade: Sales cut in half” (CNN 2010).

    During the Napster era, I was enrolled in college as a Music Industry major. My life path changed the day I saw Napster. For me, coding, and hacking had become the new rock & roll. That fall I left my music studies and began to study computers.

    Today, there’s a new rockstar turning heads: blockchain. Like Napster, blockchain has its own set of challenges — speculation, funding, regulation, censorship, etc. But these challenges aren’t necessarily new. Blockchain and Napster are both just chapters in a much longer story: the story of decentralization.

    Decentralization continues to disrupt global institutions and gives life to new ones. If you understand the causes of why it’s happening you will be positioned to make wiser decisions in the future. Wisdom, as defined by Aristotle, is an understanding of the principles and causes of our knowledge. He wanted us to ask why things are a certain way.

    My goal here is to show you why things are a certain way.

    The story of decentralization isn’t new. It begins all the way back in the Cold War. Let’s start there…

    Act I: The Early Settlers of Cyberspace: 1945–1969

    The first version of the internet begins with a rivalry between two superpowers from The Old World: The United States and the Soviet Union. To summarize the disagreement:

    The History of the Internet

    They each wanted to spread their belief system to other countries around the world. Each side was 100% certain that they were right. And they both had huge missiles pointing at each other!

    This rivalry is known as The Cold War. “Cold” because it wasn’t fought on a battlefield (It was fought by scientists in the lab!). And although it was called a “war” it was more of a race — a race between the U.S. and the Soviets to see who could invent the most revolutionary technology.

    They were neck and neck in the race until 1957 when the Soviets pulled into first place. That’s the year the Soviets launched the first-ever satellite into space: Sputnik. Sputnik showed the world that the Soviets had missiles capable of reaching any part of the world. Americans were terrified, as is seen in this ad for practical low-cost nuclear fallout shelters.

    Cold War Fallout Shelter ad in Popular Science, 1962
    Cold War Fallout Shelter ad in Popular Science, 1962

    President Dwight D. Eisenhower, in direct response to Sputnik, requested the funds from Congress to start two new agencies: The Advanced Research Projects Agency (ARPA), and the National Aeronautics and Space Administration (NASA).

    Whereas NASA would send the first man to space. ARPA would bring the first taste of cyberspace to man.

    The Beginning of ARPA: Washington, DC

    In 1963, a man named J. C. R. Licklider (known by his peers as “Lick”) working for ARPA suggested that we create an Intergalactic Computer Network. The main gist of Lick’s argument was that for the United States to compete in the technology race we needed to double-down on computer research.³

    The problem with computers, as Lick saw it, was that they were too expensive! One computer could take up an entire room. Lick proposed a solution called time-sharing. With time-sharing, you could have one central “brain” computer which could communicate with lower-cost computers. Essentially, what we today refer to as networking.

    The History of The Internet
    Lick’s proposed time-sharing, 1963

    Lick’s suggestion was implemented, and the future intergalactic computer networking was off to a fabulous start!

    Except for One Problem: Enter Paul Baran

    In 1964, a guy named Paul Baran, at the U.S. government funded RAND Corporation, pointed out a deadly design flaw with Lick’s time-sharing.

    The History of The Internet
    Paul Baran argued that centralized communication networks are vulnerable to attack, 1964

    Baran wrote a report to the U.S. Air Force where he made the argument: the U.S. government must upgrade communications from the centralized model to a newly-designed decentralized model.⁴

    If the Soviets bombed the main computer, the entire network goes down!.⁵

    Let me explain his thesis using friendly photos of The Muppets. This (below) is an example of a centralized network. As you can see all communications need to pass through Kermit. So if Kermit were to be attacked, then Fozzie Bear could no longer connect with Ms. Piggy.

    The History of The Internet
    Centralized vs. Decentralized

    But with Baran’s new proposal, if Kermit were to be attacked, Fozzie and Miss Piggy could still communicate!

    Baran’s idea for decentralization was revolutionary. Baran’s influence would soon find its way to Lick where, together (along with a team of engineers), they would build the first version of the internet, which was known as the ARPANET.

    Decentralization! It’s Alive!

    The big innovation with the ARPANET wasn’t just that you could send messages. Before the ARPANET people were already sending written messages via Morse code, telegraph, and windmills (yes, windmills). With the ARPANET two computers could now send messages to each other. What was amazing was how they did it.

    The History of The Internet
    “This cat, brought to you by decentralization”

    To explain, I think it will do us some good to dive deeper into how decentralization works. Let’s start with cats.

    If Kermit sends Fozzie a cute cat pic, that image is broken up into smaller pieces called packets.

    The History of The Internet
    An example of decentralization where a cat image moves from Kermit to Fozzie.

    The packets travel along a variety of different routes: through wires, over land and sea, and eventually reassemble when they reach their destination. The cat image above is broken into only four packets, but in real practice it would be thousands of packets.

    Each of the letters represents a server (aka. like a computer) between Kermit and Fozzie. In geek speak, we call them “nodes.” If node “D” and “G” were to fail, then the packets can just reroute through other available nodes.

    The History of The Internet
    If node D or G breaks down, the decentralized network reroutes the message

    Declaring War on Decentralization — 1969 to 1999

    By the winter of 1999, there were many speculative claims about the future of Napster. Everything from, “Napster is going to kill the record industry!” to “The government is going to regulate file sharing, it’ll never last.”

    Ultimately, both happened. Over that next decade, the RIAA (The Record Industry Association of America) made it its mission to destroy Napster! They used their strongest weapon, money, to fund a litany of lawsuits against Napster founders Shawn Fanning and Sean Parker. Two years later, Napster officially shut down to comply.

    What the RIAA didn’t know is that decentralization flows like a parade of ants. Step in their way, and they naturally find a path around your feet.

    The History of The Internet
    Decentralization flows like a parade of ants

    With Napster shut down, hundreds of Napster-copycats popped up: BitTorrent, Gnutella, Kazaa, Limewire, the list goes on. The RIAA tried to hit down each of these like a game of whack-a-mole. But they hit one down, and two more popped up!

    The History of The Internet

    In the decade between 2000 and 2009, the RIAA would spend $58 million dollars serving lawsuits to both founders of file sharing companies, and the individual users downloading music in their homes.

    Eventually, in 2009 the RIAA ended their war against decentralization. They couldn’t fight the power of the network. Somewhat ironically, the war against file sharing ended the same way the Cold War ended: Not with a climactic battle, but from exhaustion.

    How Control Exists After Decentralization

    The what-a-mole seems random if you’re just swinging the mallet from above. But peer down below the surface, and you’ll find there is an order. It’s not random.

    The History of The Internet

    If you take some time to study the machine you may start to see the pattern.

    Next up — Part Two: The Secret Hacker Code. In the next chapter we attempt to understand the pattern by looking more closely at the the people who created it. What do Licklider (the ARPANET), Shawn Fanning (Napster), Steve Jobs (Apple), and Satoshi Nakamoto (Bitcoin) all have something in common? They are all hackers. Hackers are guided by a shared code of ethics. Crack the code, and guess their next move.

    Sign up for early access to the next chapter in The History of the Internet.

    Citations and Notes

    1. Why The Arpanet Was Built, by Stephen J. Lukasik, September 2011. Lukasik was DARPA Deputy Director in 1967 and “the person who signed most of the checks for Arpanet’s development” In this essay he explains, “The goal was to exploit new computer technologies to meet the needs of military command and control against nuclear threats, achieve survivable control of US nuclear forces, and improve military tactical and management decision making.”
    2. Decentralization (as a process) existed before 1969. Throughout this piece when I refer to “decentralization,” I’m referring specifically to digitally decentralized communication networks.
    3. Memorandum for: Members and Affiliates of the Intergalactic Computer Network, J. C. R. Licklider, Washington 25, D.C. April 23, 1963. In this paper Licklider makes a case for time-sharing technology as it relates to military solutions for ARPA. “As I see it, that the military greatly needs solutions to many or most of the problems that will arise if we tried to make good use of the facilities that are coming into existence.”
    4. On Distributed Communications, Paul Baran, August 1964. In this paper Baran talks about three types of networks: centralized, decentralized and distributed. For simplicity’s sake, I chose to focus on decentralization, and intentionally omitted mentioning distributed networks. Baran writes, “This memorandum briefly reviews the distributed communication network concepts and compares it to the hierarchical or more centralized systems. The payoff in terms of survivability for a distributed configuration in the cases of enemy attacks directed against nodes, links, or combinations or nodes and links is demonstrated.”

    Very special thanks to Pippa Biddle, and Alexis Rondeau for reading early drafts and providing countless insights. Shout out to the students at One Month — Learn to code in 30 Days for your support and inspiration.

  • 50 Ways to Get a Job | Book Summary and Interview

    50 Ways to Get a Job | Book Summary and Interview

    50 Ways to Get a Job is a career book with fifty proven exercises you can use to find meaningful work.

    Last week I met with Dev Aujla to discuss his favorite takeaways from the book. One thing I have concluded after my chat with Dev: Resumes alone don’t work.

    How do most people apply for a job? Most people make a resume, apply to job boards, and then wait around hoping that someone, somewhere, will call, all the while becoming the most depressing person in history to hang out with.

    Read the full article and listen at One Month